View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12842_low_33 (Length: 226)
Name: NF12842_low_33
Description: NF12842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12842_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 3e-44; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 18 - 116
Target Start/End: Original strand, 37809333 - 37809431
Alignment:
| Q |
18 |
agatgttctttattgaatctttattgtaattgcatgtagcagaatgttagagaatatgattttaatttttaattaataccttcttctaaccttatgact |
116 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37809333 |
agatgttcttaattgaatctgtattgtaattgcatgtagcagaatgttagagaatatgattttaatttttaattaataccttcttctaaccttatgact |
37809431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 35 - 112
Target Start/End: Complemental strand, 37646457 - 37646380
Alignment:
| Q |
35 |
tctttattgtaattgcatgtagcagaatgttagagaatatgattttaatttttaattaataccttcttctaaccttat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37646457 |
tctttattgtaattgcatgtagcagaatgttagagaatatgattttaatttttaattaataccttctagtaaccttat |
37646380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 35 - 112
Target Start/End: Original strand, 37814386 - 37814463
Alignment:
| Q |
35 |
tctttattgtaattgcatgtagcagaatgttagagaatatgattttaatttttaattaataccttcttctaaccttat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37814386 |
tctttattgtaattgcatgtagcagaatgttagagaatatgattttaatttttaattaataccttctagtaaccttat |
37814463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 114 - 181
Target Start/End: Original strand, 37809461 - 37809529
Alignment:
| Q |
114 |
actaactgcctaactccctaactgtcatctgtt-agtaaagttagttagaatgcagtcagttagttaca |
181 |
Q |
| |
|
|||||||||| |||||||||||||||| | ||| || |||||| ||||||||||| ||||||||||||| |
|
|
| T |
37809461 |
actaactgccgaactccctaactgtcagccgtttagaaaagttggttagaatgcaatcagttagttaca |
37809529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 31 - 64
Target Start/End: Original strand, 51590193 - 51590226
Alignment:
| Q |
31 |
tgaatctttattgtaattgcatgtagcagaatgt |
64 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
51590193 |
tgaatctttattgtaattgcatgtaacagaatgt |
51590226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University