View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12842_low_37 (Length: 217)

Name: NF12842_low_37
Description: NF12842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12842_low_37
NF12842_low_37
[»] chr4 (1 HSPs)
chr4 (16-204)||(40819328-40819517)
[»] chr5 (1 HSPs)
chr5 (46-125)||(32016261-32016342)


Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 16 - 204
Target Start/End: Original strand, 40819328 - 40819517
Alignment:
16 aaaaatgtaatttatttggattatatacctttt-ttaggcaaaataaattcatatcatttcattgaagataataataatatcaatataatggcgaggaga 114  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
40819328 aaaaatgtaatttatttggattatatacctttttttaggcaaaataaattcatatcatttcattcaagataataataatatcaatataatggcgaggaga 40819427  T
115 gtaaaagatacgactaatcgctctggctaaattatgaacgatatattagattgtctatggataaaagctagagcaaaactagcaacagtg 204  Q
    |||||||| ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| ||||    
40819428 gtaaaagacacgactaatcgctcttgctaaattatgaacgatctattagattgtttatggataaaagctagagcaaaactagcaatagtg 40819517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 46 - 125
Target Start/End: Complemental strand, 32016342 - 32016261
Alignment:
46 tttttaggcaaaataaattcatatcatttcattgaagataataat---aatatcaatataatggcgaggagagtaaaagatac 125  Q
    |||||||| |||  || |||||||||||||||| ||||||||| |   ||||| ||||||||||  |||||||||||||||||    
32016342 tttttagggaaagcaacttcatatcatttcattcaagataatagtatcaatat-aatataatgggaaggagagtaaaagatac 32016261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University