View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12842_low_38 (Length: 210)
Name: NF12842_low_38
Description: NF12842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12842_low_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 14 - 200
Target Start/End: Complemental strand, 34460048 - 34459862
Alignment:
| Q |
14 |
gaagcatagatagttgaacgataaacacttgattttctcactttactaactagtaactactcactctagagtttagaggagttaaatccatctattagca |
113 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34460048 |
gaagcatagatagttgaacgataaatacttgattttctcactttactaactagtaactactcactctagagtttagaggagttaaatccatctattagca |
34459949 |
T |
 |
| Q |
114 |
atagaacagaacattaatgttggattttgcttgattagtatagggccatatgcatatcgacttatttaagcaattgaaactgtgatg |
200 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34459948 |
atagaacagaacattaatgttagattttgcttgattagtatagggccatatgcatatcgacttatttaagcaattgaaactgtgatg |
34459862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University