View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12843_high_10 (Length: 215)

Name: NF12843_high_10
Description: NF12843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12843_high_10
NF12843_high_10
[»] chr4 (3 HSPs)
chr4 (1-215)||(35441123-35441337)
chr4 (146-208)||(6604076-6604138)
chr4 (1-40)||(6603931-6603970)
[»] chr2 (1 HSPs)
chr2 (151-208)||(3699405-3699462)


Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 35441123 - 35441337
Alignment:
1 tgttcaaggcggctcaaaaacagtttggttaccaagctgataaagaaacagaaaagtcgggtaatgacatgaatgcagaggctgctcttaaaaatgggaa 100  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35441123 tgttcaaggcggctcaaaaacaatttggttaccaagctgataaagaaacagaaaagtcgggtaatgacatgaatgcagaggctgctcttaaaaatgggaa 35441222  T
101 ccaaatgaattatcaagatgacttccctgatgactgttacctgcgctgtgttggcactgttattggtttcaaagatggtgatgtggaggtgaaattggct 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35441223 ccaaatgaattatcaagatgacttccctgatgactgttacctgcgctgtgttggcactgttattggtttcaaagatggtgatgtggaggtgaaattggct 35441322  T
201 actggtttcacaacc 215  Q
    |||||||||||||||    
35441323 actggtttcacaacc 35441337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 146 - 208
Target Start/End: Original strand, 6604076 - 6604138
Alignment:
146 ctgtgttggcactgttattggtttcaaagatggtgatgtggaggtgaaattggctactggttt 208  Q
    |||| |||||| ||||| |||||||||||||||| ||||||||||||||| ||||||||||||    
6604076 ctgtattggcaatgttactggtttcaaagatggtcatgtggaggtgaaatgggctactggttt 6604138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 6603931 - 6603970
Alignment:
1 tgttcaaggcggctcaaaaacagtttggttaccaagctga 40  Q
    |||||||||||||||||||||||| |||||||| ||||||    
6603931 tgttcaaggcggctcaaaaacagtctggttacctagctga 6603970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 151 - 208
Target Start/End: Complemental strand, 3699462 - 3699405
Alignment:
151 ttggcactgttattggtttcaaagatggtgatgtggaggtgaaattggctactggttt 208  Q
    |||||| ||||| |||||||||||||||| ||||||||||||||| ||||||||||||    
3699462 ttggcaatgttactggtttcaaagatggtcatgtggaggtgaaatgggctactggttt 3699405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University