View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12843_high_10 (Length: 215)
Name: NF12843_high_10
Description: NF12843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12843_high_10 |
 | |
|
| [»] chr4 (3 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 35441123 - 35441337
Alignment:
| Q |
1 |
tgttcaaggcggctcaaaaacagtttggttaccaagctgataaagaaacagaaaagtcgggtaatgacatgaatgcagaggctgctcttaaaaatgggaa |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35441123 |
tgttcaaggcggctcaaaaacaatttggttaccaagctgataaagaaacagaaaagtcgggtaatgacatgaatgcagaggctgctcttaaaaatgggaa |
35441222 |
T |
|
| Q |
101 |
ccaaatgaattatcaagatgacttccctgatgactgttacctgcgctgtgttggcactgttattggtttcaaagatggtgatgtggaggtgaaattggct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35441223 |
ccaaatgaattatcaagatgacttccctgatgactgttacctgcgctgtgttggcactgttattggtttcaaagatggtgatgtggaggtgaaattggct |
35441322 |
T |
|
| Q |
201 |
actggtttcacaacc |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
35441323 |
actggtttcacaacc |
35441337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 146 - 208
Target Start/End: Original strand, 6604076 - 6604138
Alignment:
| Q |
146 |
ctgtgttggcactgttattggtttcaaagatggtgatgtggaggtgaaattggctactggttt |
208 |
Q |
| |
|
|||| |||||| ||||| |||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
6604076 |
ctgtattggcaatgttactggtttcaaagatggtcatgtggaggtgaaatgggctactggttt |
6604138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 6603931 - 6603970
Alignment:
| Q |
1 |
tgttcaaggcggctcaaaaacagtttggttaccaagctga |
40 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
6603931 |
tgttcaaggcggctcaaaaacagtctggttacctagctga |
6603970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 151 - 208
Target Start/End: Complemental strand, 3699462 - 3699405
Alignment:
| Q |
151 |
ttggcactgttattggtttcaaagatggtgatgtggaggtgaaattggctactggttt |
208 |
Q |
| |
|
|||||| ||||| |||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
3699462 |
ttggcaatgttactggtttcaaagatggtcatgtggaggtgaaatgggctactggttt |
3699405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University