View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12843_low_11 (Length: 258)
Name: NF12843_low_11
Description: NF12843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12843_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 28829768 - 28830015
Alignment:
| Q |
1 |
aaaaatggtctgatcctatctctggtactttgccgttgacaagcaagattggagcggggctgctagccggtgggattggcgcggctgtcgggaatccggc |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28829768 |
aaaaatggtctgatcctatctccggtactttgccgttgacaagcaagattggagcggggctgctagccggtgggattggcgcggctgtcgggaatccggc |
28829867 |
T |
 |
| Q |
101 |
tgatgtggcaatggttaggatgcaggccgatggaagacttccatcggcccaaagaagaaactataaatctgtggtcaacgccatctccaggatggcgaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
28829868 |
tgatgtggcaatggttaggatgcaggccgatggaagacttccatcggcccaaagaagaaactataaatctgtcgtcgacgccatctccaggatggcgaaa |
28829967 |
T |
 |
| Q |
201 |
gacgagggagttactagcctatggcgcggttcatctctaacagtgaac |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28829968 |
gacgagggagttactagcctatggcgcggttcatctctgacagtgaac |
28830015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University