View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12843_low_6 (Length: 291)
Name: NF12843_low_6
Description: NF12843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12843_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 3 - 273
Target Start/End: Complemental strand, 42555197 - 42554927
Alignment:
| Q |
3 |
cgtgctaataattgcaccatataatgcaaaaaatgtaagatagattagaaaataaaaatataattatagattctgaaactatttatttaggnnnnnnntc |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
42555197 |
cgtgctaataattgcaccatataatgcaaaaaatgtaagatagattagaaaataaaaatataattatagattctgaaactatttatttaggaaaaaaatc |
42555098 |
T |
 |
| Q |
103 |
tgaatctagattgaccttcctctaccaaattcaagaagcttttcaagttcactttaaggagatatttgtattagtggcgtgaaggtcctagtatgagaga |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42555097 |
tgaatctagattgaccttcctctaccaaattcaagaagcttttcaagttcactttaaggagatatttgtattagtggcgtgaaggtcctagtatgagaga |
42554998 |
T |
 |
| Q |
203 |
tatttcttttcaccagatataaaaacaaacctttaatttcttttctgatatggaaaaacaaaccaagaaca |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42554997 |
tatttcttttcaccagatataaaaacaaacctttaatttcttttctgatatggaaaaacaaatcaagaaca |
42554927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University