View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12844_high_2 (Length: 369)
Name: NF12844_high_2
Description: NF12844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12844_high_2 |
 | |
|
| [»] scaffold0126 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0126 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: scaffold0126
Description:
Target: scaffold0126; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 20 - 359
Target Start/End: Original strand, 27708 - 28047
Alignment:
| Q |
20 |
catgtgagtttttggaagccatgagcatagaattgttatttgcaccttaaaaacttgcatctacttgttcttgttgttcagcttcttcaaaagccaaaga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27708 |
catgtgagtttttggaagccatgagcatagaattgttatttgtacctaaaaaacttgcatctacttgttcttgttgttcagcttcttcaaaagccaaaga |
27807 |
T |
|
| Q |
120 |
aaaccccattaataattaaacttgtttctgtcttttgcccttaaaatcatttcatttgtctacacaaagagatagagaaaagaagctttatatgaggaag |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27808 |
aaaccccattaataattaaacttgtttctgtcttttgcccttaaaatcatttcatttgtctacacaaagagatagagaaaagaagctttatatgaggaag |
27907 |
T |
|
| Q |
220 |
agtcggttataaacttatttgaaatagggtatagaagagagcgatattaaagagagaaaatggacttgaatgctatgaaactaaacaacaaaacnnnnnn |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
27908 |
agtcggttataaacttatttgaaatagggtatagaagagagtgatattaaagagagaaaatggacttcaatgccatgaaactaaacaacaaaactttttt |
28007 |
T |
|
| Q |
320 |
nctttcttttatatctatatgtatttctctctcccctttg |
359 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28008 |
tctttcctttatatctatatgtatttctctctcccctttg |
28047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University