View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12844_high_7 (Length: 213)
Name: NF12844_high_7
Description: NF12844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12844_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 18 - 200
Target Start/End: Original strand, 47981832 - 47982014
Alignment:
| Q |
18 |
gtttcgatccaatgtcctcacttttaatcaggtcattgcaatcacaaccttacttctgcttcaatttcttatgattatctgtgtaacattgccagttcag |
117 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47981832 |
gtttcgatccgatgtcctcacttttaatcaggtcattgcaatcacaaccttacttctgcttcaatttcttatgattatctgtgtaacattgccacttcag |
47981931 |
T |
 |
| Q |
118 |
attgaagacttttccaacgaccaattatattcaatagtttcatttttattaattattaccggtgtctggtgtctctgtcagtg |
200 |
Q |
| |
|
||||||||| | ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47981932 |
attgaagacgtgtccaatgaccaattatattcaatagtttcatttttattaattattaccggtgtctggtgtctctgtcagtg |
47982014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 18 - 95
Target Start/End: Complemental strand, 35117945 - 35117867
Alignment:
| Q |
18 |
gtttcgatccaatgtcctcacttttaatcaggtcattgcaatcacaaccttacttctgcttca-atttcttatgattat |
95 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35117945 |
gtttcgatccgatgtcctcacttttattcaggtcattgcaatcacaaccttacttctgcttcatttttcttatgattat |
35117867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University