View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12844_high_8 (Length: 213)
Name: NF12844_high_8
Description: NF12844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12844_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 17 - 194
Target Start/End: Original strand, 46895194 - 46895371
Alignment:
| Q |
17 |
agatcgtatacatacgggtacgctagtacgagaaacaagaacatataatcaattatatcaatccgatcgcaattcattaaaattaatagttgtgatatat |
116 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46895194 |
agatcgtatacatacgggtacgttagtacgagaaacgagaacatataatcaattatatcaatccgatcgcaattcattaaaattaatagttgtgatatat |
46895293 |
T |
 |
| Q |
117 |
ttttaattaaaagacgtcggtgatctaaaattaatggttttgttgagatctataccatccggtcttgattgaacggtc |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |||||||||||||||| |
|
|
| T |
46895294 |
ttttaattaaaagacgtcggtgatctaaaattaatggttttgttgagatctacaccgtccgatcttgattgaacggtc |
46895371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University