View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12844_low_5 (Length: 317)
Name: NF12844_low_5
Description: NF12844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12844_low_5 |
 |  |
|
| [»] scaffold0775 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0775 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: scaffold0775
Description:
Target: scaffold0775; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 8 - 157
Target Start/End: Complemental strand, 502 - 350
Alignment:
| Q |
8 |
gagcacagagcaattgtatcaggccttgcgcgatgttagggagaggttggcacccgttttgaccggaaggcagcagcaggactagga---gaagtaggac |
104 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
502 |
gagcacagagcagttgtatcaggccttgcgcgatgttagggagaggttggcacccgttttgaccggaaggcagcagcaggactaggagaagaagtaggac |
403 |
T |
 |
| Q |
105 |
tagttgatgtgtaggacttgtttttagttttaatgttgagacatgagatagac |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
402 |
tagttgatgtgtaggacttgtttttagttttaatgttgagacatgagatagac |
350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0775; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 211 - 261
Target Start/End: Complemental strand, 296 - 246
Alignment:
| Q |
211 |
acgcatgtggtaactttaagagaaaatgtatcggttgaatctaatatttat |
261 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
296 |
acgcatgtggtaactttaagagataatgtatcggttgaatctaatatttat |
246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University