View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12846_high_3 (Length: 373)
Name: NF12846_high_3
Description: NF12846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12846_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 7 - 362
Target Start/End: Complemental strand, 36389967 - 36389613
Alignment:
| Q |
7 |
tattcctggcttcacaaaggtgccctttcttgcagcaccgacctctgtaaaggcatacccactactaggttaccctcttttcctcacctcctctctttta |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| | |
|
|
| T |
36389967 |
tattcctggcttcacaaaggtgccctttcttgcagcaccgacctctgtaaaggcatacccactactaggtt-ccctcttttcctcacttcctctctttca |
36389869 |
T |
 |
| Q |
107 |
tttttcttcaattggcttgnnnnnnnagtgtaccctttatgattattttgttgggtttttctttaattgattatttgaccctaaatcaatggtaaaaatt |
206 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36389868 |
tttttcttcaattggcttgtttttttagtgtaccctttatgattattttgttgggtttttctctaattgattatttgactctaaatcaatggtaaaaatt |
36389769 |
T |
 |
| Q |
207 |
tgatttttaataatgggttcaattgggtcagaaaaggggttaactatgtatattgtgttacaggcacattgagtattgtatgcatagagtgaatttgctg |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36389768 |
tgatttttaataatgggttcaattgggtcagaaaaggggttaactatgtatattgtgttacaggcacattgagtattgtatgcatagagtgaatttgctg |
36389669 |
T |
 |
| Q |
307 |
agacattatggtgttaagcctattcttgtatttgatggagggcttttaccagtgaa |
362 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36389668 |
agacattatggtgttaagcctattcttgtatttgatggagggcttttaccaatgaa |
36389613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University