View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12846_high_8 (Length: 256)
Name: NF12846_high_8
Description: NF12846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12846_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 7 - 242
Target Start/End: Original strand, 39994384 - 39994619
Alignment:
| Q |
7 |
ttcacaacgtaaaacaaaccaatcttatcactcagagtatcagatttgcgcgaagacaaagacgaattcgaaatggcgtagaaattagcgagttgaagta |
106 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39994384 |
ttcacaacgtaacacaaaccgatcttatcactgagagtatcagatttgcgcgaagacaaagacgaattcgaaatggcgtagaaattagcgagttgaagta |
39994483 |
T |
 |
| Q |
107 |
gcgactgaaatgaaaacacgaagaaacaacgagaaatcgacgatcgattaggaatgatgaaattgtccggtgcttcaatgaatagagattgagatttagg |
206 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39994484 |
gcgactgaattgaaaacacgaagaaacaacgagaaatcgacgatcgattaggaatgatgaaattgtgcggtgcttcaatgaatagagattgagatttagg |
39994583 |
T |
 |
| Q |
207 |
gatgaagctgtgtgtacctgctttaggtctcctagc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
39994584 |
gatgaagctgtgtgtacctgctttaggtctcctagc |
39994619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University