View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12848_low_5 (Length: 300)
Name: NF12848_low_5
Description: NF12848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12848_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 272; Significance: 1e-152; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 17 - 288
Target Start/End: Complemental strand, 39582913 - 39582642
Alignment:
| Q |
17 |
caaaatccactgcaggcaccatcgtagcgccattgcttcaaccatagtaggagaaatttgaatcttctctagctttgttgcagcaaacttgacattccct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39582913 |
caaaatccactgcaggcaccatcgtagcgccattgcttcaaccatagtaggagaaatttgaatcttctctagctttgttgcagcaaacttgacattccct |
39582814 |
T |
 |
| Q |
117 |
tcactatacctccaattaccatcccacatcctatatgaccatcattgataacttctgcatcaacattcagtttcaccataccaaagggtggaggacacca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39582813 |
tcactatacctccaattaccatcccacatcctatatgaccatcattgataacttctgcatcaacattcagtttcaccataccaaagggtggaggacacca |
39582714 |
T |
 |
| Q |
217 |
tttctcaacagtttgtgcagcaggttccgctgccccttcaaatctattagcatagttaaattcatcagtgaa |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39582713 |
tttctcaacagtttgtgcagcaggttccgctgccccttcaaatctattagcatagttaaattcatcagtgaa |
39582642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 84 - 116
Target Start/End: Complemental strand, 53330849 - 53330817
Alignment:
| Q |
84 |
tctagctttgttgcagcaaacttgacattccct |
116 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
53330849 |
tctaactttgttgcagcaaacttgacattccct |
53330817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University