View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12848_low_6 (Length: 213)
Name: NF12848_low_6
Description: NF12848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12848_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 14 - 165
Target Start/End: Complemental strand, 8112153 - 8112002
Alignment:
| Q |
14 |
tctctctcttaggtactcattcgtgtgagaaatggataaatcatatattttttggtgtgtaatatctcagttgttggataggtgcaacagagaaagatgc |
113 |
Q |
| |
|
||||||||||||| ||||| |||||||||||| ||||||||||| |||||||| | |||||||||||||||| ||||||||| |||||| ||| ||||| |
|
|
| T |
8112153 |
tctctctcttaggcactcaatcgtgtgagaaagggataaatcatgtattttttagggtgtaatatctcagtttttggataggggcaacaatgaaggatgc |
8112054 |
T |
|
| Q |
114 |
agacatacagacggttgaggaaccagatccgaaatttgctgactcttggttt |
165 |
Q |
| |
|
||| |||| ||| |||||||| ||||||| | || ||| ||| ||||||||| |
|
|
| T |
8112053 |
agatatacggactgttgaggatccagatctgcaacttgttgattcttggttt |
8112002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 13 - 82
Target Start/End: Original strand, 1087467 - 1087536
Alignment:
| Q |
13 |
ttctctctcttaggtactcattcgtgtgagaaatggataaatcatatattttttggtgtgtaatatctca |
82 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1087467 |
ttctctctcttaggcactcaatcgtgtgagaaagggataaatcatatattttttggtgtgtaatatctca |
1087536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University