View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12848_low_6 (Length: 213)

Name: NF12848_low_6
Description: NF12848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12848_low_6
NF12848_low_6
[»] chr4 (1 HSPs)
chr4 (14-165)||(8112002-8112153)
[»] chr6 (1 HSPs)
chr6 (13-82)||(1087467-1087536)


Alignment Details
Target: chr4 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 14 - 165
Target Start/End: Complemental strand, 8112153 - 8112002
Alignment:
14 tctctctcttaggtactcattcgtgtgagaaatggataaatcatatattttttggtgtgtaatatctcagttgttggataggtgcaacagagaaagatgc 113  Q
    ||||||||||||| ||||| |||||||||||| ||||||||||| |||||||| | |||||||||||||||| ||||||||| ||||||  ||| |||||    
8112153 tctctctcttaggcactcaatcgtgtgagaaagggataaatcatgtattttttagggtgtaatatctcagtttttggataggggcaacaatgaaggatgc 8112054  T
114 agacatacagacggttgaggaaccagatccgaaatttgctgactcttggttt 165  Q
    ||| |||| ||| |||||||| ||||||| | || ||| ||| |||||||||    
8112053 agatatacggactgttgaggatccagatctgcaacttgttgattcttggttt 8112002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 13 - 82
Target Start/End: Original strand, 1087467 - 1087536
Alignment:
13 ttctctctcttaggtactcattcgtgtgagaaatggataaatcatatattttttggtgtgtaatatctca 82  Q
    |||||||||||||| ||||| |||||||||||| ||||||||||||||||||||||||||||||||||||    
1087467 ttctctctcttaggcactcaatcgtgtgagaaagggataaatcatatattttttggtgtgtaatatctca 1087536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University