View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1284_high_11 (Length: 316)

Name: NF1284_high_11
Description: NF1284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1284_high_11
NF1284_high_11
[»] chr2 (1 HSPs)
chr2 (167-312)||(14436331-14436475)
[»] chr3 (1 HSPs)
chr3 (167-310)||(2333077-2333220)


Alignment Details
Target: chr2 (Bit Score: 86; Significance: 4e-41; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 167 - 312
Target Start/End: Complemental strand, 14436475 - 14436331
Alignment:
167 ggctatgctatttgatttacttgacaggttaccggaacagcaaacgctaacaactgccatgactctttggagtttgtggaagagccagaatctgaaccta 266  Q
    ||||||||||||||||||||||||||||||| | ||||| |||| |||||||||||||||||||||||||||||||||||||||||  ||||||||  ||    
14436475 ggctatgctatttgatttacttgacaggttaacagaacatcaaaggctaacaactgccatgactctttggagtttgtggaagagccgcaatctgaagtta 14436376  T
267 tgggaatctaccgatactatccctactgtcatcgtatctcgtgccc 312  Q
    ||||||| || |||||||| ||| | || |||||||||||||||||    
14436375 tgggaatatatcgatacta-ccccagtgccatcgtatctcgtgccc 14436331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 80; Significance: 2e-37; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 167 - 310
Target Start/End: Original strand, 2333077 - 2333220
Alignment:
167 ggctatgctatttgatttacttgacaggttaccggaacagcaaacgctaacaactgccatgactctttggagtttgtggaagagccagaatctgaaccta 266  Q
    ||||||| ||||||||||||||||||||||||||||||| |||| ||||||||||| ||||||||| |||||||||||||||||||  ||||| ||  ||    
2333077 ggctatgttatttgatttacttgacaggttaccggaacaacaaaggctaacaactgtcatgactctctggagtttgtggaagagccgcaatctaaagtta 2333176  T
267 tgggaatctaccgatactatccctactgtcatcgtatctcgtgc 310  Q
    ||||||||||| ||||||| | ||  || |||||||||||||||    
2333177 tgggaatctactgatactaccgctgttgccatcgtatctcgtgc 2333220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University