View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1284_high_11 (Length: 316)
Name: NF1284_high_11
Description: NF1284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1284_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 86; Significance: 4e-41; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 167 - 312
Target Start/End: Complemental strand, 14436475 - 14436331
Alignment:
| Q |
167 |
ggctatgctatttgatttacttgacaggttaccggaacagcaaacgctaacaactgccatgactctttggagtttgtggaagagccagaatctgaaccta |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||| |||| ||||||||||||||||||||||||||||||||||||||||| |||||||| || |
|
|
| T |
14436475 |
ggctatgctatttgatttacttgacaggttaacagaacatcaaaggctaacaactgccatgactctttggagtttgtggaagagccgcaatctgaagtta |
14436376 |
T |
|
| Q |
267 |
tgggaatctaccgatactatccctactgtcatcgtatctcgtgccc |
312 |
Q |
| |
|
||||||| || |||||||| ||| | || ||||||||||||||||| |
|
|
| T |
14436375 |
tgggaatatatcgatacta-ccccagtgccatcgtatctcgtgccc |
14436331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 80; Significance: 2e-37; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 167 - 310
Target Start/End: Original strand, 2333077 - 2333220
Alignment:
| Q |
167 |
ggctatgctatttgatttacttgacaggttaccggaacagcaaacgctaacaactgccatgactctttggagtttgtggaagagccagaatctgaaccta |
266 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |||| ||||||||||| ||||||||| ||||||||||||||||||| ||||| || || |
|
|
| T |
2333077 |
ggctatgttatttgatttacttgacaggttaccggaacaacaaaggctaacaactgtcatgactctctggagtttgtggaagagccgcaatctaaagtta |
2333176 |
T |
|
| Q |
267 |
tgggaatctaccgatactatccctactgtcatcgtatctcgtgc |
310 |
Q |
| |
|
||||||||||| ||||||| | || || ||||||||||||||| |
|
|
| T |
2333177 |
tgggaatctactgatactaccgctgttgccatcgtatctcgtgc |
2333220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University