View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1284_high_4 (Length: 418)
Name: NF1284_high_4
Description: NF1284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1284_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 58; Significance: 3e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 29 - 86
Target Start/End: Original strand, 1141410 - 1141467
Alignment:
| Q |
29 |
aaatattgtcaaaaatatctatttagtgtgatttgattgatgcacatattaataattt |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1141410 |
aaatattgtcaaaaatatctatttagtgtgatttgattgatgcacatattaataattt |
1141467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University