View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1284_high_7 (Length: 365)
Name: NF1284_high_7
Description: NF1284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1284_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 30 - 364
Target Start/End: Complemental strand, 33828285 - 33827951
Alignment:
| Q |
30 |
tttttcattaagatatacataagtttttaatttctttttaaccataaacctgtttaagttatatcaccaacttaatcaaataattcctctcatattaact |
129 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33828285 |
tttttcgttaagacatacataagtttttaatttctttttaaccataaacctgtttaagttatatcaccaacttaatcaaataattcctctcatattaact |
33828186 |
T |
|
| Q |
130 |
ataattgttttaataacttttcagccattaccggatgatttcaaaactacatcattactgacttcttgcaccgtgtaaaatttatcattgcagcattaaa |
229 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33828185 |
ataattgttttaataatttttcagccattaccggatgatttcaaaactacatcattactgacttcttgcaccgtgtaaaatttatcattgcagcattaaa |
33828086 |
T |
|
| Q |
230 |
atctcacttccaattccaaaatcacgcattatcatcattacagtggaagctgttcatctgtcgcatatgatatcgaaaccgttttcccagaaagagtttc |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33828085 |
atctcacttccaattccaaaatcacgcattatcatcattacagtggaagctgttcatctgtcgcatatgatatcgaaaccgttttcccagaaagagtttc |
33827986 |
T |
|
| Q |
330 |
ttactgtattgattgtatggcctatgatactacac |
364 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33827985 |
ttactgtattgattgtatggcctataatactacac |
33827951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University