View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1284_low_15 (Length: 345)
Name: NF1284_low_15
Description: NF1284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1284_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 72; Significance: 1e-32; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 167 - 262
Target Start/End: Complemental strand, 14436475 - 14436380
Alignment:
| Q |
167 |
ggctatgctatttgatttacttgacaggttaccggaacagcaaacgctaacaactgccatgactctttggagtttgtggaagagccagaatctgaa |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||| |||| ||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14436475 |
ggctatgctatttgatttacttgacaggttaacagaacatcaaaggctaacaactgccatgactctttggagtttgtggaagagccgcaatctgaa |
14436380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 66; Significance: 4e-29; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 167 - 252
Target Start/End: Original strand, 2333077 - 2333162
Alignment:
| Q |
167 |
ggctatgctatttgatttacttgacaggttaccggaacagcaaacgctaacaactgccatgactctttggagtttgtggaagagcc |
252 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |||| ||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
2333077 |
ggctatgttatttgatttacttgacaggttaccggaacaacaaaggctaacaactgtcatgactctctggagtttgtggaagagcc |
2333162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University