View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1284_low_21 (Length: 297)

Name: NF1284_low_21
Description: NF1284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1284_low_21
NF1284_low_21
[»] chr1 (1 HSPs)
chr1 (36-242)||(5422828-5423034)


Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 36 - 242
Target Start/End: Original strand, 5422828 - 5423034
Alignment:
36 aagatgatgaaaagtgtacatgccacacaaataaatggtgaatgtagcaataaagaacaccatagtatcttgccatccaatagagtactgagactgtgtt 135  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
5422828 aagatgatgaaaagtgtacatgccacacaaataaatggtaaatgtagcaataaagaacgccatagtatcttgccatccaatagagtactgagactgtgtt 5422927  T
136 tgaattggaaccattgaggattggtatgttgaaggattaggaaatggtaaccatagtgatctttgcattgagatggaattttattatctttgttgtgaat 235  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||    
5422928 tgaattggaaccattgaggattggtatgttgaaggattaggaaatggtaaccatagtgatctttgcattgagatggaattttattttctttgttgtcaat 5423027  T
236 attcttg 242  Q
     ||||||    
5423028 tttcttg 5423034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University