View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1284_low_23 (Length: 210)

Name: NF1284_low_23
Description: NF1284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1284_low_23
NF1284_low_23
[»] chr7 (1 HSPs)
chr7 (43-115)||(44968695-44968767)
[»] chr5 (2 HSPs)
chr5 (43-115)||(28872139-28872211)
chr5 (43-115)||(28873578-28873651)


Alignment Details
Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 43 - 115
Target Start/End: Original strand, 44968695 - 44968767
Alignment:
Q  43 gagatgaaaataaaacttgtaaattttatttatgaattgaacttgctatttacaagagctatgaagtatttat 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44968695 gagatgaaaataaaacttgtaaattttatttatgaattgaacttgctatttacaagagctatgaagtatttat 44968767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 43 - 115
Target Start/End: Original strand, 28872139 - 28872211
Alignment:
Q  43 gagatgaaaataaaacttgtaaattttatttatgaattgaacttgctatttacaagagctatgaagtatttat 115  Q
    |||| ||||||||||||||||||||||||| || |||||||||| |||||||||||||| |||||||||||||    
T  28872139 gagacgaaaataaaacttgtaaattttattgataaattgaacttactatttacaagagcaatgaagtatttat 28872211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 43 - 115
Target Start/End: Original strand, 28873578 - 28873651
Alignment:
Q  43 gagatgaaaataaaacttgtaaattttatttatg-aattgaacttgctatttacaagagctatgaagtatttat 115  Q
    |||||||||||||||||||||||||||||| ||| |||| ||||| || ||||||||||| |||||||||||||    
T  28873578 gagatgaaaataaaacttgtaaattttattgatgaaattaaacttactctttacaagagcaatgaagtatttat 28873651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University