View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1284_low_4 (Length: 485)
Name: NF1284_low_4
Description: NF1284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1284_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 2e-93; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 2e-93
Query Start/End: Original strand, 16 - 197
Target Start/End: Original strand, 22907895 - 22908076
Alignment:
| Q |
16 |
atgccaatccagttaactcggaaaaactatttggcaaaattacattcatccttctcacttaatcatgttttggagattcagtcacaataggctacccaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22907895 |
atgccaatccagttaactcggaaaaactatctggcaaaattacattcatccttctcacttaatcatgttttggagattcagtcacaataggctacccaaa |
22907994 |
T |
|
| Q |
116 |
gatgataatcatttgggtagagtagaggttatgtttttgtatctcattgttgcttctgttagaatgcttacgagacttcctc |
197 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22907995 |
gatgataattatttgggtagagtagaggttatgtttttgtatctcattgttgcttctgttagaatgcttacgagacttcctc |
22908076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 160; E-Value: 5e-85
Query Start/End: Original strand, 220 - 387
Target Start/End: Original strand, 22908107 - 22908274
Alignment:
| Q |
220 |
ttgttgctcacttgtcctttctccactcaaatatgggtctggttttctcatatgattggctatatcatggatagatcctctctcatttcttcgcttgttt |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
22908107 |
ttgttgctcacttgtcctttctccactcaaatatgggtctggttttctcatatgattggctatatcattgatagatcctctctcatttctacgcttgttt |
22908206 |
T |
|
| Q |
320 |
cctgtaagcatgcttggagtaaccaggttcacgatgtcattcttactgccattactcatatcatctgg |
387 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22908207 |
cctgtaagcatgcttggagtaaccaggttcacgatgtcattcttactgccattactcatatcatctgg |
22908274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University