View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1284_low_7 (Length: 411)
Name: NF1284_low_7
Description: NF1284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1284_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 2e-50; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 99 - 204
Target Start/End: Original strand, 46750964 - 46751069
Alignment:
| Q |
99 |
catgatgatggtgatgatgattattatgttttcttttaccagttttgtgttactgaatttgagacttttaaagccttcaaggacttgttcctgagatagg |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46750964 |
catgatgatggtgatgatgattattatgttttcttttaccagttttgcgttactgaatttgagacttttaaagccttcaaggacttgttcctgagatagg |
46751063 |
T |
|
| Q |
199 |
gtgctt |
204 |
Q |
| |
|
|||||| |
|
|
| T |
46751064 |
gtgctt |
46751069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 237 - 312
Target Start/End: Original strand, 46751102 - 46751177
Alignment:
| Q |
237 |
ctgagctacctcctagctctttggtgcatgatgttgaagttccatgttaattttgtactttagcataatttctctc |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46751102 |
ctgagctacctcctagctctttggtgcatgatgttgaagttccatgttaattttgtactttagcataatttctctc |
46751177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 365 - 395
Target Start/End: Original strand, 46751226 - 46751256
Alignment:
| Q |
365 |
aattcatcatcactagtcactactctctctc |
395 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
46751226 |
aattcatcatcactagtcactactctctctc |
46751256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University