View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1285-Insertion-10 (Length: 362)
Name: NF1285-Insertion-10
Description: NF1285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1285-Insertion-10 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 84; Significance: 7e-40; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 239 - 362
Target Start/End: Original strand, 56474013 - 56474136
Alignment:
| Q |
239 |
gttatgtgcttgtttatgatgttggttttggttagaagagaatgagtttgattgttgatgttggttttcaactctctagccccttaatttgaaattgggt |
338 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||| | |||||||||||||||||||||||||||| ||||| |||||||||||| ||| | |
|
|
| T |
56474013 |
gttaggtgcttgtttgtgatgttggttttggttagaagagaataaatttgattgttgatgttggttttcaactccctagcaccttaatttgaatgtggat |
56474112 |
T |
|
| Q |
339 |
gtttgtttgagttttttctattga |
362 |
Q |
| |
|
||||||||||||||||| |||||| |
|
|
| T |
56474113 |
gtttgtttgagttttttttattga |
56474136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University