View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1285-Insertion-19 (Length: 576)
Name: NF1285-Insertion-19
Description: NF1285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1285-Insertion-19 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 542; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 542; E-Value: 0
Query Start/End: Original strand, 7 - 576
Target Start/End: Original strand, 45968384 - 45968953
Alignment:
| Q |
7 |
agaaataattcatcttttctcacaagatgttatcattctcgtacaatgtctacatctatctctaataatcctcttttgctcaatcttgatcacaaaacca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45968384 |
agaaataattcatcttttctcacaagatgtcatcattctcgtacaatgtctacatctatctctaataatcctcttttgctcaatcttgatcacaaaacca |
45968483 |
T |
|
| Q |
107 |
agcaccacccttcttgtatattgaagtttggacgcataatgaacggttttcaaaaagttttgcggtcaccctcttggagtttttgccattcaagagcgtt |
206 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45968484 |
agcaccacccttcttctatattgaagtttggacgcataatgaacggttttcaaaaagttttgcggtcaccctcttggagtttttgccattcaagagcgtt |
45968583 |
T |
|
| Q |
207 |
tcttggtttaaaagcaacaaaaacagaatgcatatcttctattggtggagtacccttcaaggcacgtgaattctcaaactcttttgagaccacacgtgtc |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45968584 |
tcttggtttaaaagcaacaaaaacagaatgcatatcttctattggtggagtatccttcaaggcacgtgaattctcaaactcttttgagaccacacgtgtc |
45968683 |
T |
|
| Q |
307 |
ttaaaaattgacaaagatgataacaagggtggaggggatgaggaagatttgaaggagaagaattgtgatagtttgaagaatgtaattgaggcaaagaatg |
406 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45968684 |
ttaagaattgacaaagatgataacaagggtggaggggatgaggaagatttgaaggagaagaattgtgatagtttgaagaatgtaattgtggcaaagaatg |
45968783 |
T |
|
| Q |
407 |
gtgatgaggaagagacagaggtggaaaaagatgcatggaagttattgcagaaagcgcttgttacatattgtgatacacctgttggaactgttgcggcaaa |
506 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45968784 |
gtgatgaggaagagacagatgtggagaaagatgcatggaagttattgcagaaagcgcttgttacatattgtgatacacctgttggaactgttgcggcaaa |
45968883 |
T |
|
| Q |
507 |
tgatgattcggggtcacccttgaattatgatcaggtctttattcgagatttcgtcccttctgctcttgct |
576 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45968884 |
tgatgattcggggtcacccttgaattatgatcaggtctttattcgagatttcgtcccttctgctcttgct |
45968953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University