View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1285-Insertion-23 (Length: 223)
Name: NF1285-Insertion-23
Description: NF1285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1285-Insertion-23 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 26 - 223
Target Start/End: Original strand, 23830833 - 23831030
Alignment:
| Q |
26 |
tattaaggattttgtccaatcaaaacaaaacaaaagggggtccattacagttaaaccagttcccacaacatgtcatacaatgaatgtcatgcatggatca |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23830833 |
tattaaggattttgtccaatcaaaacaaaacaaaagggggtccattacagttaaaccagttcccacaacatgtcatacaatgaatgtcatgcatgaatca |
23830932 |
T |
 |
| Q |
126 |
ccatactcaccttccttcgtcccctttacctttcatacgcgtctttactaatacatccaaacttatagtcaagttgctcaactcttttaacaccgtta |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23830933 |
ccatactcaccttccttcgtcccctttacctttcatacacgtctttactaatacatccaaacttatagtcaagttgctcaactcttttaacactgtta |
23831030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 122 - 159
Target Start/End: Original strand, 23817379 - 23817416
Alignment:
| Q |
122 |
atcaccatactcaccttccttcgtcccctttacctttc |
159 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
23817379 |
atcaccatactcaccttccttcgtcccattcacctttc |
23817416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University