View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1285-Insertion-24 (Length: 209)
Name: NF1285-Insertion-24
Description: NF1285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1285-Insertion-24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 7 - 208
Target Start/End: Complemental strand, 14743281 - 14743080
Alignment:
| Q |
7 |
atttccatcatctcaacacggtgttgctcggttaacaaacaatgctgctcaggtaacatagtattgatgttatctcttgtatttacctttttagataatc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14743281 |
atttccatcatctcaacacggtgttgctcggttaacaaacaatgctgctcaggtaacatagtattgatgttatctcttgtatttacctttttagataatc |
14743182 |
T |
|
| Q |
107 |
atatgatgttaattaataaatatttattcagcaggagcgacatgagaggtgcttttgtttctctaaatctaaatattcaaaatctccaaaacttaaggtg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14743181 |
atatgatgttaattaataaatatttattcagcaggagcgacatgagaggtgcttttgtttctctaaatctaaatattcaaaatctccaaaacttaaggtg |
14743082 |
T |
|
| Q |
207 |
tt |
208 |
Q |
| |
|
|| |
|
|
| T |
14743081 |
tt |
14743080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 150 - 209
Target Start/End: Complemental strand, 14746168 - 14746109
Alignment:
| Q |
150 |
gagaggtgcttttgtttctctaaatctaaatattcaaaatctccaaaacttaaggtgttc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
14746168 |
gagaggtgcttttgtttctctaaatctaaatattcaagaattccaaaacttaaggtgttc |
14746109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 70 - 130
Target Start/End: Original strand, 14289443 - 14289503
Alignment:
| Q |
70 |
ttgatgttatctcttgtatttacctttttagataatcatatgatgttaattaataaatatt |
130 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| | || |||| ||||||||||||| |
|
|
| T |
14289443 |
ttgatgttatctcttgtattttcctttttagataatggtctgctgttgattaataaatatt |
14289503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University