View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12850_high_30 (Length: 202)
Name: NF12850_high_30
Description: NF12850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12850_high_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 19 - 189
Target Start/End: Complemental strand, 31059996 - 31059826
Alignment:
| Q |
19 |
cttaggctgctacacctctgcaataaagcattttcacaaagacgggcattttaaactgacacgtcgacaatggtaataaattcagaagaagaaaaataat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |
|
|
| T |
31059996 |
cttaggctgctacacctctgcaataaagcattttcacaaagacgggcattttaaactgacacgtcgacaatggtaataaattcagaagaaaaaaaaaaat |
31059897 |
T |
 |
| Q |
119 |
tgaataaaatcacatgtcgtattgtctgacaccgattgtcatgtgatgtttttccttctctcatttggtct |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31059896 |
tgaataaaatcacatgtcgtattgtctgacaccgattgtcatgtgatgtttttccttctctcatttggtct |
31059826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 152 - 189
Target Start/End: Original strand, 31175995 - 31176032
Alignment:
| Q |
152 |
gattgtcatgtgatgtttttccttctctcatttggtct |
189 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
31175995 |
gattatcatgtgacgtttttccttctctcatttggtct |
31176032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 152 - 189
Target Start/End: Original strand, 20812425 - 20812462
Alignment:
| Q |
152 |
gattgtcatgtgatgtttttccttctctcatttggtct |
189 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
20812425 |
gattatcacgtgatgtttttccttctctcatttggtct |
20812462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University