View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12850_low_18 (Length: 369)
Name: NF12850_low_18
Description: NF12850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12850_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 58; Significance: 3e-24; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 294 - 351
Target Start/End: Complemental strand, 29154755 - 29154698
Alignment:
| Q |
294 |
taattgcttggccctcttcatgttacatgcagaaaaagaacagaggaaattggggaag |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29154755 |
taattgcttggccctcttcatgttacatgcagaaaaagaacagaggaaattggggaag |
29154698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University