View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12850_low_18 (Length: 369)

Name: NF12850_low_18
Description: NF12850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12850_low_18
NF12850_low_18
[»] chr7 (1 HSPs)
chr7 (294-351)||(29154698-29154755)


Alignment Details
Target: chr7 (Bit Score: 58; Significance: 3e-24; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 294 - 351
Target Start/End: Complemental strand, 29154755 - 29154698
Alignment:
294 taattgcttggccctcttcatgttacatgcagaaaaagaacagaggaaattggggaag 351  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29154755 taattgcttggccctcttcatgttacatgcagaaaaagaacagaggaaattggggaag 29154698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University