View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12850_low_23 (Length: 308)
Name: NF12850_low_23
Description: NF12850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12850_low_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 17 - 290
Target Start/End: Complemental strand, 33555215 - 33554951
Alignment:
| Q |
17 |
cactggtcactaactttatgactccaatgaaccatagtacctggaagtcacgtgcacatgcacggcacttaagggtgtggatcacatcctatccttgtct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33555215 |
cactggtcactaactttatgactccaatgaaccatagtacctggaagtcacgtgcacatgcagggcacttaagggtgtggatcacatcctatccttgtct |
33555116 |
T |
|
| Q |
117 |
catgtaaatccaaaatctcttttgtccactactcctgctgctaatgtgtgtgagagaatcttcacactcattttgcattctcaacggcggtccattgcac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33555115 |
catgtaaatccaaaatctcttttgtccactactcctgctgctaatgtgtgtgagagaatcttcacactcattttgcattctcaacggcggtccatt---- |
33555020 |
T |
|
| Q |
217 |
catgcatgcaatggaccgtaatcattatatttatcagatcaacaatccgttgcacagtgcattagtggtatatc |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
33555019 |
-----atgcaatggaccgtaatcattatatttatcagatcaacaatccgttgcaccgtgcattaatggtatatc |
33554951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University