View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12850_low_34 (Length: 237)
Name: NF12850_low_34
Description: NF12850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12850_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 19 - 219
Target Start/End: Complemental strand, 3566105 - 3565905
Alignment:
| Q |
19 |
cttctggactatgtcaggagtggacaaaggttgtgtaatctacttttcatcctcatcttcttcattatggtcttgtgttgcatcgacaaaggaaccctac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
3566105 |
cttctggactatgtcaggagtggacaaaggttgtgtaatctgctcttcatcctcatcttcttcattatggtcttgtgttgcatcgacaaaggaaccttac |
3566006 |
T |
 |
| Q |
119 |
gtgctagtatcatcttgcgcattcacatctaagtctccaacataattaacttgaatgttggcctttatttccacttctatttgcaaatcttgggccttta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3566005 |
gtgctagtatcatcttgcgcattcacatctaagtctccaacagaattaacttgaatgttggcatttatttccacttctatttgcaaatcttgggccttta |
3565906 |
T |
 |
| Q |
219 |
a |
219 |
Q |
| |
|
| |
|
|
| T |
3565905 |
a |
3565905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University