View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12850_low_41 (Length: 211)
Name: NF12850_low_41
Description: NF12850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12850_low_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 14 - 198
Target Start/End: Original strand, 54546477 - 54546663
Alignment:
| Q |
14 |
gaactcatttgtcaacaacgcgcattgtgttgggacaatgaaaaagaaaatgcaaattttccaccaaacctc--caaaacatgcatagagtgaaattgca |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||| |||||||||||||||||||||| |
|
|
| T |
54546477 |
gaactcatttgtcaacaacgcgcattgtgttgggacaatgaaaaagaaaatgcaaattttccacccaacctctccaacacatgcatagagtgaaattgca |
54546576 |
T |
 |
| Q |
112 |
gcctccgactagtttagaagacactttttgcacaccctccatagcagattcttttatcttccatgcttctctaccttccaaatccta |
198 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54546577 |
gcctccacctagtttagaagacactttttgcacaccctccatagcagattcttttatcttccatgcttctctaccttccaaatccta |
54546663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University