View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12851_high_11 (Length: 235)
Name: NF12851_high_11
Description: NF12851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12851_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 33 - 220
Target Start/End: Complemental strand, 3382728 - 3382543
Alignment:
| Q |
33 |
tactaataacatagagtcctctnnnnnnngagtatgaagttaatatgcaagcaatttaaggaccaaatattcaatttttaatctaaatcaaacgatataa |
132 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
3382728 |
tactaataacatagagtcctctaaaaaaagagtatgaagttaatatgcaagcaatttaaggaccaaatattcaattt--aatctaaatcaaatgatataa |
3382631 |
T |
 |
| Q |
133 |
aaatataaccgagataaaagcactacttatttgatggtgatcaagaaatgatgagattaaataatattgtttccctcgttgataatgt |
220 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3382630 |
aaatataaccgagataaaagcaccacttatttgatggtgatcaagaaatgatgagataaaataatattgtttccctcgttgataatgt |
3382543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University