View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12851_high_6 (Length: 283)
Name: NF12851_high_6
Description: NF12851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12851_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 24 - 262
Target Start/End: Complemental strand, 8257935 - 8257701
Alignment:
| Q |
24 |
gaatacattaaaggggtcaaataccatgtctgaaaatgcatgtcagcccccaagagaggatcgtgattctaaacacacccctttcttatattcccatcta |
123 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| ||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||| |
|
|
| T |
8257935 |
gaatacattaaaggagtcaaataccatgtatgaaaatgtatgtcagcccccaagagaggatcgtgattataaactcatccctttcttatattcccatcta |
8257836 |
T |
 |
| Q |
124 |
ttatctatccttttctaagatgtttgtcaaaagtgtggtggtcatgttacatcaaagtttcatggtgtggtggaaattggctgaacatgaaagtttcacg |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||| |
|
|
| T |
8257835 |
ttatctatccttttctaagatgtttgtcaaaagtgtgatggtcatgttacatcaaagtttcatggtgtggtggaaattggctgaacaagaaagtttaacg |
8257736 |
T |
 |
| Q |
224 |
ggttaagtgagttgtggtgtgtcgaccaaagagaggtgt |
262 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8257735 |
ggt----tgagttgtggtgtgtcgaccaaagagaggtgt |
8257701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University