View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12852_low_12 (Length: 227)
Name: NF12852_low_12
Description: NF12852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12852_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 17 - 205
Target Start/End: Original strand, 47708028 - 47708216
Alignment:
| Q |
17 |
agtattgagattgctgatgcaattttggaatgtgtgatcagggatgaagtagtatcagatatcattgaaattttatcacgcaacaaaattaatttctgtt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47708028 |
agtattgagattgctgatgcaattttggaatgtgtgattagggatgaagtagtatcagatatcattgaaattttatcacacaacaaaattaatttctgtt |
47708127 |
T |
 |
| Q |
117 |
gttgtaagtaatatctcctgtccataagccattgcttcttaaatgatgggttgcttgctctctctacttctttgttcgaatttaaaatg |
205 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47708128 |
gttgtaagtaatatctcatgtcaataagccattgcttcttaaatgatgggttgcttgctctctctacttctttgttcgaattgaaaatg |
47708216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University