View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12852_low_6 (Length: 303)
Name: NF12852_low_6
Description: NF12852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12852_low_6 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 76; Significance: 4e-35; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 205 - 303
Target Start/End: Complemental strand, 9787284 - 9787185
Alignment:
| Q |
205 |
caacatcct-agatagcattttcattcatggtaactttaagatgctatatcagcatttcacacattttggttttggctgcaacaatggtactctctctgc |
303 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9787284 |
caacatccttagatagcattttcatttatggtaactttaagatgctatctcagcattgcacacattttggttttggctgcaacaatggtaccctctctgc |
9787185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 64; Significance: 5e-28; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 216 - 303
Target Start/End: Complemental strand, 30144664 - 30144578
Alignment:
| Q |
216 |
atagcattttcattcatggtaactttaagatgctatatcagcatttcacacattttggttttggctgcaacaatggtactctctctgc |
303 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
30144664 |
atagcatttttattcatggtaactttaa-atgctatatcagcacttcacacattttggttttggctgaaacaatggtattctctctgc |
30144578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University