View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12853_high_5 (Length: 238)
Name: NF12853_high_5
Description: NF12853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12853_high_5 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 16 - 238
Target Start/End: Complemental strand, 32719817 - 32719597
Alignment:
| Q |
16 |
catatatggctcatatttgctactaacttgtaaattgtagtaccaataatatttaaacactttaaatgtaaatttaagacttgaataattggataactac |
115 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32719817 |
catatatggctcatatt-gctactaacttgtaaactgtagtaccaacaatatttaaacactttaaatgtaaatttaagacttgaataattggataactac |
32719719 |
T |
 |
| Q |
116 |
aatagcaactttatccttaaaacatatagaaacaattgatcatattctttgacaaacnnnnnnnnttagatcatattctataatgatttcgtttatatta |
215 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| || |||||||||||| || |||||||||||||||| |
|
|
| T |
32719718 |
aatagcaactttatcctt-aaacacatagaaacaattgatcatattctttgacaaacaaacaaaatttgatcatattctacaacgatttcgtttatatta |
32719620 |
T |
 |
| Q |
216 |
tttatgtactttatttatctatt |
238 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
32719619 |
tttatgtactttatttatctatt |
32719597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University