View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12853_low_2 (Length: 574)
Name: NF12853_low_2
Description: NF12853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12853_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 310; Significance: 1e-174; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 12 - 395
Target Start/End: Original strand, 32724771 - 32725161
Alignment:
| Q |
12 |
tgagatgaaaaagcaacttaatttattattttgagtgttca-----tttcactagtgtatgttctatgtaatataggtctaggttttattgtatctagga |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32724771 |
tgagatgaaaaagcaacttaatttattattttgagtgttcatttcatttcactagtgtatgttctatgtaatataggtctaggttttattgtatctagga |
32724870 |
T |
|
| Q |
107 |
gcagctagtgaatttgtaacaattcaactaatgttgccagttttcaatctatttccatgttcaaattgatgagtattttttggacgtattactggtttat |
206 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32724871 |
gcagctgttgaatttgtaacaattgaactaatgttgccagttttcaatctatttccatgttcaaattgatgagtattttttgcacgtattactggtttat |
32724970 |
T |
|
| Q |
207 |
gcggacagcatgattttcattagacacattgtcatttgttttgaggattgatacttcaaaatgctcttttattaaatgcccctattgtaattgcatagat |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
32724971 |
gcggacagcatgattttcattagacacattgtcatttgttttgaggattgatacttcaaaatgctcttttattaaatgcccctattgtaattgcatagtt |
32725070 |
T |
|
| Q |
307 |
gttcc--nnnnnnnnnngttatgaatttaaaggtactcacatttattttgttggtttatcccttttatagattgtagcagcaacaacggtt |
395 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32725071 |
gttccttttttttttttgttatgaatttaaaggtactcacatttattttgttggtttatcccttttatagattgtagcagcaacaacggtt |
32725161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 470 - 542
Target Start/End: Original strand, 32725721 - 32725793
Alignment:
| Q |
470 |
gaattcatgctccacaaaggcagtgacttaaaaagttaaatgatgagtactggcttataaaacaaatacttta |
542 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32725721 |
gaattcatgctccataaaggcagtgacttaaaaagttaaatgatgagtactggcttataaaacaaatacttta |
32725793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University