View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12853_low_8 (Length: 236)
Name: NF12853_low_8
Description: NF12853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12853_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 13 - 218
Target Start/End: Complemental strand, 43911708 - 43911503
Alignment:
| Q |
13 |
agcacagaatcaaagtccactgctgagcctgcagctccagtaactacctctgcttcagaggagaaggcgatggccattgatgtggacactaactaagttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43911708 |
agcacagaatcaaagtccactgctgagccttcagctccagtaactacctctgcttcagaggagaaggcgatggccattgatgtggacactaactaagttt |
43911609 |
T |
|
| Q |
113 |
ctaccaatttaatcttatgattttggtatggaactttataaagctgaaggnnnnnnnngcagtattttgactttttctaccagtttttagtttactattt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | |||||||| |||||| |
|
|
| T |
43911608 |
ctaccaatttaatcttatgattttggtatggaactttataaagctgaagggaaaaaaagcagtattttgactttttctaccattctttagtttgctattt |
43911509 |
T |
|
| Q |
213 |
tctcgt |
218 |
Q |
| |
|
|||||| |
|
|
| T |
43911508 |
tctcgt |
43911503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 45 - 145
Target Start/End: Complemental strand, 8633776 - 8633681
Alignment:
| Q |
45 |
agctccagtaactacctctgcttcagaggagaaggcgatggccattgatgtggacactaactaagtttctaccaatttaatcttatgattttggtatgga |
144 |
Q |
| |
|
|||||||| |||||||||||||||||||||| | || |||| |||||||||||| || ||||||||||||||| |||| ||||||||| ||| ||| |
|
|
| T |
8633776 |
agctccagcaactacctctgcttcagaggagca-gcaatggaaattgatgtggac----accaagtttctaccaattcaatcatatgattttcgtaggga |
8633682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University