View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12855_high_12 (Length: 275)
Name: NF12855_high_12
Description: NF12855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12855_high_12 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 18 - 275
Target Start/End: Complemental strand, 53721886 - 53721628
Alignment:
| Q |
18 |
tcttgatctctcaagtttcatttcacgtgggtttctcaaagtgttgcttacacannnnnnn-ggcattctgtccacctcctccacccttagtttccttga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
53721886 |
tcttgatctctcaagtttcatttcacgtgggtttctcaaagtgttgcttacacattttttttggcattctgtccacctcctccacccttagtttacttga |
53721787 |
T |
|
| Q |
117 |
tcgatatcatcactaatttgcgaccggaggtggacaaactgtcaacagagttgtgttggcttctctttgtaaaatcttcctgatatttttatatatacac |
216 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53721786 |
tcgatctcatcactaatttgcgaccggaggtggacaaactgtcaacagagttgtgttggcttctctttgtaaaatcttcctgatatttttatatatacac |
53721687 |
T |
|
| Q |
217 |
atctcaatcaattcattctttttacctcgcatattagctgccatgccaaactcctgtgg |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53721686 |
atctcaatcaattcattctttttacctcgcatattagctgccatgccaaactcctgtgg |
53721628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University