View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12855_high_15 (Length: 251)
Name: NF12855_high_15
Description: NF12855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12855_high_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 7633851 - 7634092
Alignment:
| Q |
1 |
acagatatcttccgtagctcgtgtgcaattgtagatggtaaactctt-agtcggataaaatcacaatgggtacataactcccccgaatacaagttaacat |
99 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7633851 |
acagatatcttccgcagctcgtgtacaattgtagatagtaaactcttgagtcggataaaatcacaatgggtacataactcccccaaatacaagttaacat |
7633950 |
T |
|
| Q |
100 |
tataagatgaaaacatattacaagtctcttttaatcacttcccaaattacaaatgaaaccattatcaattgatctagaaataatacaaactttgaggcat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7633951 |
tataagatgaaaacatattacaagtctcttttaatcacttcccaaattacaaatgaaaccattatcaattgatctagaaataatacaaactttgaggcat |
7634050 |
T |
|
| Q |
200 |
gcaaataacataactaattgtcaatagtacatatatcctatg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7634051 |
gcaaataacataactaattgtcaatagtacatatatcctatg |
7634092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 137 - 230
Target Start/End: Original strand, 7622306 - 7622396
Alignment:
| Q |
137 |
cttcccaaattacaaatgaaaccattatcaattgatctagaaataatacaaactttgaggcatgcaaataacataactaattgtcaatagtaca |
230 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7622306 |
cttcccaaattactaatgaacccattatcaattgatctagaaata---caaactttgaggcatgcaaataacataactaactgtcaatagtaca |
7622396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University