View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12855_low_11 (Length: 284)
Name: NF12855_low_11
Description: NF12855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12855_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 18 - 269
Target Start/End: Original strand, 7633476 - 7633727
Alignment:
| Q |
18 |
atgctagctgtttagtgaggaaacgtgcaattttctcgtttgttgagattggtagtaatcaaagtattcttttttgaatatttatgctaaccaagtgaca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7633476 |
atgctagctgtttagtgaggaaacgtgcaattttctcatttgttgagattggtagtaatcaaagtattcttttttgaatatttatgctaaccaagcgaca |
7633575 |
T |
 |
| Q |
118 |
atcgatttttaaatgctcaattctttcatggaacactgaatttgaagctatatgtatcgcactctgactttcacagtagagaaccggtggtcgtgcacaa |
217 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7633576 |
atcgatttttaaatgctcagttctttcatggaacactgaatttgaagctatatgtattgcactctgactttcacaatagagaaccggtggtcgtgcacaa |
7633675 |
T |
 |
| Q |
218 |
gcaacatcaaatcatgcaacaagtataaaagtcattgtagctcacatgtgac |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7633676 |
gcaacatcaaatcatgcaacaagtataaaagtcattgtagctcacatgtgac |
7633727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University