View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12855_low_3 (Length: 478)
Name: NF12855_low_3
Description: NF12855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12855_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 180 - 463
Target Start/End: Complemental strand, 5140219 - 5139936
Alignment:
| Q |
180 |
tttattttattgtcagccttctggatcataaccaagctcaagtatccatgtagaatcctgagaaccagtttcatgcttgcatgttatcagaaatatttgt |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5140219 |
tttattttattgtcagccttctggatcataaccaagctcaagtatccatgtagaatcctgagaaccagtttcatgcttgcatgttatcagaaatatttgt |
5140120 |
T |
 |
| Q |
280 |
gtttcttctgttttaaatgatatgtatattggtgtatgtctatctgaccatacttaaggtcgcaagtgctaagctgttttaatcataactacattaaata |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5140119 |
gtttcttctgttttaaatgatatgtatattggtgtatgtctatctgaccatacttaaggtcgcaagtgctaagctgttttaatcataactacattaaata |
5140020 |
T |
 |
| Q |
380 |
tgtgcagcaaagccactcatatgtcaaattaagtctgtctgcactgcctgacttagaccatgctttaaagtttgtgtcatattt |
463 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5140019 |
tgtgcagcaaagccactcatatgtcaaattaagtctgtctgcactgcctgacttagaccatgctttaaagtttgtgtcatattt |
5139936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University