View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12856_low_1 (Length: 394)
Name: NF12856_low_1
Description: NF12856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12856_low_1 |
 |  |
|
| [»] scaffold0586 (2 HSPs) |
 |  |  |
|
| [»] scaffold1234 (1 HSPs) |
 |  |  |
|
| [»] scaffold0012 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 27 - 224
Target Start/End: Original strand, 10680026 - 10680223
Alignment:
| Q |
27 |
aaaaaagtgacatcgtaatcatcatcctaacacacacacgcaaagcaggaagaaaataaagataactgagaaaagactaaagataattgaaagaattatc |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
10680026 |
aaaaaagtgacatcgtaatcatcatcctaacacacacacgcaaagcaggaagaaaataaagataactgggaaaagactagagataattgaaagaattatc |
10680125 |
T |
 |
| Q |
127 |
tgaagagattaaacgacaaagataaaagtatttctcatttatttaagagaataaaggaaaaaactttgtcccccgctatggtgcggtacaaaagaagg |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10680126 |
tgaagagattaaacgacaaagataaaagtatttctcatttatttaagagaataaaggaaaaaactttgtcccccgctatggtgcggtacaaaagaagg |
10680223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 190 - 384
Target Start/End: Original strand, 10680263 - 10680467
Alignment:
| Q |
190 |
ctttgtcccccgctatggtgcggtacaaaagaaggacatattttcaatatttgtactgctttgtgtttcatatttaaacaaatcaaacataccaaaagag |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10680263 |
ctttgtcccccgctatggtgcggtacaaaagaaggacatatttccaatatttgtactgctttgtgtttcatatttaaacaaatcaaacacaccaaaagag |
10680362 |
T |
 |
| Q |
290 |
gaattaaagaannnnnnnnctgccctagtttttgcc----------aaaaatacctcactttttcgaaaaattgcataaatgctctactttttcaggggt |
379 |
Q |
| |
|
||||||||||| ||| ||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10680363 |
gaattaaagaattttttttctgtcctagtttttgccaaaaaaacataaaaatacctcactttttcgaaaaattgcataaatgttctactttttcaggggt |
10680462 |
T |
 |
| Q |
380 |
ctctg |
384 |
Q |
| |
|
||||| |
|
|
| T |
10680463 |
ctctg |
10680467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 328 - 380
Target Start/End: Complemental strand, 10681978 - 10681926
Alignment:
| Q |
328 |
aaatacctcactttttcgaaaaattgcataaatgctctactttttcaggggtc |
380 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
10681978 |
aaataccccactttttcgaaaaattgcagaaatgccctactttttcaggggtc |
10681926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 336 - 384
Target Start/End: Complemental strand, 17963508 - 17963460
Alignment:
| Q |
336 |
cactttttcgaaaaattgcataaatgctctactttttcaggggtctctg |
384 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||| ||||||| |
|
|
| T |
17963508 |
cactttttcgaaaaattgcacaaatgccctactttttcagatgtctctg |
17963460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 326 - 371
Target Start/End: Original strand, 4390754 - 4390799
Alignment:
| Q |
326 |
aaaaatacctcactttttcgaaaaattgcataaatgctctactttt |
371 |
Q |
| |
|
|||||| |||||||||| | ||||||||||||||||| |||||||| |
|
|
| T |
4390754 |
aaaaatgcctcacttttgcaaaaaattgcataaatgccctactttt |
4390799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 52; Significance: 1e-20; HSPs: 9)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 384
Target Start/End: Complemental strand, 46683670 - 46683595
Alignment:
| Q |
310 |
tgccctagtttttgccaaaaa-tacctcactttttcgaaaaattgcataaatgctctactttttcaggggtctctg |
384 |
Q |
| |
|
|||||||||||||| |||||| |||| |||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
46683670 |
tgccctagtttttgtcaaaaaataccccactttttcgaaaaattgcagaaatgccctactttttcaggggtctctg |
46683595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 325 - 384
Target Start/End: Complemental strand, 2228156 - 2228097
Alignment:
| Q |
325 |
caaaaatacctcactttttcgaaaaattgcataaatgctctactttttcaggggtctctg |
384 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| ||||||||| ||||||||||| |
|
|
| T |
2228156 |
caaaaatacctcactttttcgaaaaattgcagaaatgccctactttttaaggggtctctg |
2228097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 325 - 384
Target Start/End: Original strand, 46683379 - 46683438
Alignment:
| Q |
325 |
caaaaatacctcactttttcgaaaaattgcataaatgctctactttttcaggggtctctg |
384 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
46683379 |
caaaaataccccactttttcgaaaaattgcagaaatgccctactttttcaggggtctctg |
46683438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 325 - 384
Target Start/End: Original strand, 47477311 - 47477370
Alignment:
| Q |
325 |
caaaaatacctcactttttcgaaaaattgcataaatgctctactttttcaggggtctctg |
384 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
47477311 |
caaaaataccccactttttcgaaaaattgctgaaatgccctactttttcaggggtctctg |
47477370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 337 - 373
Target Start/End: Original strand, 680662 - 680698
Alignment:
| Q |
337 |
actttttcgaaaaattgcataaatgctctactttttc |
373 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
680662 |
actttttcgaaaaattgcataaatgccctactttttc |
680698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 325 - 381
Target Start/End: Complemental strand, 5153375 - 5153319
Alignment:
| Q |
325 |
caaaaatacctcactttttcgaaaaattgcataaatgctctactttttcaggggtct |
381 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||| ||||||||||||| |||| |
|
|
| T |
5153375 |
caaaaataccttacttttttgaaaaattgcataaatatcctactttttcaggtgtct |
5153319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 325 - 384
Target Start/End: Complemental strand, 47478679 - 47478620
Alignment:
| Q |
325 |
caaaaatacctcactttttcgaaaaattgcataaatgctctactttttcaggggtctctg |
384 |
Q |
| |
|
|||||||| | | |||||||||||||||||| ||||| ||||||||| ||||||||||| |
|
|
| T |
47478679 |
caaaaatatcccgctttttcgaaaaattgcagaaatgtcctacttttttaggggtctctg |
47478620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 337 - 375
Target Start/End: Original strand, 49617161 - 49617199
Alignment:
| Q |
337 |
actttttcgaaaaattgcataaatgctctactttttcag |
375 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
49617161 |
actttttcgaaaaattgcacaaatgccctactttttcag |
49617199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 325 - 375
Target Start/End: Original strand, 51745846 - 51745896
Alignment:
| Q |
325 |
caaaaatacctcactttttcgaaaaattgcataaatgctctactttttcag |
375 |
Q |
| |
|
||||||| || ||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
51745846 |
caaaaatgccccactttttcgaaaaattgcgcaaatgccctactttttcag |
51745896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 51; Significance: 4e-20; HSPs: 6)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 325 - 383
Target Start/End: Original strand, 34002964 - 34003022
Alignment:
| Q |
325 |
caaaaatacctcactttttcgaaaaattgcataaatgctctactttttcaggggtctct |
383 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
34002964 |
caaaaatacctcactttttcgaaaaattgcagaaatgccctactttttcaggggtctct |
34003022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 325 - 375
Target Start/End: Complemental strand, 13828978 - 13828928
Alignment:
| Q |
325 |
caaaaatacctcactttttcgaaaaattgcataaatgctctactttttcag |
375 |
Q |
| |
|
||||||| || |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13828978 |
caaaaatgccccactttttcgaaaaattgcaaaaatgctctactttttcag |
13828928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 336 - 383
Target Start/End: Original strand, 37987514 - 37987561
Alignment:
| Q |
336 |
cactttttcgaaaaattgcataaatgctctactttttcaggggtctct |
383 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||||||| |||||| |
|
|
| T |
37987514 |
cactttttcgaaaaattgcagaaatgccctactttttcaggagtctct |
37987561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 337 - 372
Target Start/End: Original strand, 13614818 - 13614853
Alignment:
| Q |
337 |
actttttcgaaaaattgcataaatgctctacttttt |
372 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
13614818 |
actttttcgaaaaattgcataaatgccctacttttt |
13614853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 337 - 375
Target Start/End: Original strand, 13827617 - 13827655
Alignment:
| Q |
337 |
actttttcgaaaaattgcataaatgctctactttttcag |
375 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
13827617 |
actttttcgaaaaattgcaaaaatgccctactttttcag |
13827655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 325 - 375
Target Start/End: Complemental strand, 19685724 - 19685674
Alignment:
| Q |
325 |
caaaaatacctcactttttcgaaaaattgcataaatgctctactttttcag |
375 |
Q |
| |
|
||||||| || ||||||| | ||||||||||||||||| |||||||||||| |
|
|
| T |
19685724 |
caaaaatgccccacttttgcaaaaaattgcataaatgccctactttttcag |
19685674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 6e-16; HSPs: 13)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 325 - 384
Target Start/End: Original strand, 4349932 - 4349991
Alignment:
| Q |
325 |
caaaaatacctcactttttcgaaaaattgcataaatgctctactttttcaggggtctctg |
384 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
4349932 |
caaaaatatctcactttttcgaaaaattgcagaaatgtcctactttttcaggggtctctg |
4349991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 325 - 381
Target Start/End: Complemental strand, 3334746 - 3334690
Alignment:
| Q |
325 |
caaaaatacctcactttttcgaaaaattgcataaatgctctactttttcaggggtct |
381 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||| ||||||||||| |||||| |
|
|
| T |
3334746 |
caaaaataccccactttttcgaaaaattgcagaaatgccctactttttcatgggtct |
3334690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 325 - 384
Target Start/End: Complemental strand, 55515611 - 55515551
Alignment:
| Q |
325 |
caaaaatacctcactttttc-gaaaaattgcataaatgctctactttttcaggggtctctg |
384 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
55515611 |
caaaaataccccactttttttgaaaaattgcaaaaatgccctactttttcaggggtctctg |
55515551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 337 - 384
Target Start/End: Complemental strand, 3087991 - 3087944
Alignment:
| Q |
337 |
actttttcgaaaaattgcataaatgctctactttttcaggggtctctg |
384 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
3087991 |
actttttcgaaaaattgcagaaatgccatactttttcaggggtctctg |
3087944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 325 - 383
Target Start/End: Original strand, 3086437 - 3086495
Alignment:
| Q |
325 |
caaaaatacctcactttttcgaaaaattgcataaatgctctactttttcaggggtctct |
383 |
Q |
| |
|
|||||||||| | ||||||||||||||||| |||||| ||| |||||||||||||||| |
|
|
| T |
3086437 |
caaaaataccctattttttcgaaaaattgcagaaatgccctattttttcaggggtctct |
3086495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 325 - 375
Target Start/End: Original strand, 10224431 - 10224481
Alignment:
| Q |
325 |
caaaaatacctcactttttcgaaaaattgcataaatgctctactttttcag |
375 |
Q |
| |
|
||||||| || ||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
10224431 |
caaaaatgccccactttttcgaaaaattgcgtaaatgccctactttttcag |
10224481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 325 - 375
Target Start/End: Original strand, 23356630 - 23356680
Alignment:
| Q |
325 |
caaaaatacctcactttttcgaaaaattgcataaatgctctactttttcag |
375 |
Q |
| |
|
||||||| || |||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
23356630 |
caaaaatgccccactttttcgaaaaattgcaaaaatgccctactttttcag |
23356680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 325 - 374
Target Start/End: Original strand, 55514755 - 55514804
Alignment:
| Q |
325 |
caaaaatacctcactttttcgaaaaattgcataaatgctctactttttca |
374 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
55514755 |
caaaaataccccactttttcgaaaaattgctgaaatgccctactttttca |
55514804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 339 - 375
Target Start/End: Complemental strand, 33953107 - 33953071
Alignment:
| Q |
339 |
tttttcgaaaaattgcataaatgctctactttttcag |
375 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33953107 |
tttttcgaaaaattgcataaatgccctactttttcag |
33953071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 325 - 375
Target Start/End: Complemental strand, 19137869 - 19137819
Alignment:
| Q |
325 |
caaaaatacctcactttttcgaaaaattgcataaatgctctactttttcag |
375 |
Q |
| |
|
||||||| || ||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
19137869 |
caaaaatgccccactttttcgaaaaattgcgcaaatgccctactttttcag |
19137819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 325 - 375
Target Start/End: Complemental strand, 23357992 - 23357942
Alignment:
| Q |
325 |
caaaaatacctcactttttcgaaaaattgcataaatgctctactttttcag |
375 |
Q |
| |
|
||||||| || || ||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
23357992 |
caaaaatgccccattttttcgaaaaattgcaaaaatgccctactttttcag |
23357942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 25728727 - 25728772
Alignment:
| Q |
339 |
tttttcgaaaaattgcataaatgctctactttttcaggggtctctg |
384 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
25728727 |
tttttcgaaaaattgcagaaatatcctactttttcaggggtctctg |
25728772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 326 - 374
Target Start/End: Complemental strand, 10231268 - 10231220
Alignment:
| Q |
326 |
aaaaatacctcactttttcgaaaaattgcataaatgctctactttttca |
374 |
Q |
| |
|
|||||| || ||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
10231268 |
aaaaatgccccactttttcgaaaaattgcgcaaatgccctactttttca |
10231220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 6e-16; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 325 - 384
Target Start/End: Complemental strand, 14147015 - 14146956
Alignment:
| Q |
325 |
caaaaatacctcactttttcgaaaaattgcataaatgctctactttttcaggggtctctg |
384 |
Q |
| |
|
|||||||||| |||||||||||||||| ||| |||||| ||||||||||||||||||||| |
|
|
| T |
14147015 |
caaaaataccccactttttcgaaaaatggcagaaatgccctactttttcaggggtctctg |
14146956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 325 - 382
Target Start/End: Original strand, 14145593 - 14145650
Alignment:
| Q |
325 |
caaaaatacctcactttttcgaaaaattgcataaatgctctactttttcaggggtctc |
382 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
14145593 |
caaaaataccccactttttcgaaaaattgcagaaatggcctactttttcaggggtctc |
14145650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 337 - 373
Target Start/End: Complemental strand, 34880481 - 34880445
Alignment:
| Q |
337 |
actttttcgaaaaattgcataaatgctctactttttc |
373 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
34880481 |
actttttcgaaaaattgcataaatgccctactttttc |
34880445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 325 - 371
Target Start/End: Original strand, 36626423 - 36626469
Alignment:
| Q |
325 |
caaaaatacctcactttttcgaaaaattgcataaatgctctactttt |
371 |
Q |
| |
|
||||||| |||||||||| | ||||||||||||||||| |||||||| |
|
|
| T |
36626423 |
caaaaatgcctcacttttgcaaaaaattgcataaatgccctactttt |
36626469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 325 - 370
Target Start/End: Complemental strand, 33373213 - 33373168
Alignment:
| Q |
325 |
caaaaatacctcactttttcgaaaaattgcataaatgctctacttt |
370 |
Q |
| |
|
||||||| || ||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
33373213 |
caaaaatgccccactttttcgaaaaattgcgtaaatgccctacttt |
33373168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 325 - 370
Target Start/End: Original strand, 34506375 - 34506420
Alignment:
| Q |
325 |
caaaaatacctcactttttcgaaaaattgcataaatgctctacttt |
370 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||| ||||||| |
|
|
| T |
34506375 |
caaaaataccttactttttcgaaaaattgcccaaatgccctacttt |
34506420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 328 - 381
Target Start/End: Original strand, 43962768 - 43962821
Alignment:
| Q |
328 |
aaatacctcactttttcgaaaaattgcataaatgctctactttttcaggggtct |
381 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
43962768 |
aaataccccactttttcgaaaaattgcagaaatgctttactttttcaggggtct |
43962821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 18655135 - 18655180
Alignment:
| Q |
339 |
tttttcgaaaaattgcataaatgctctactttttcaggggtctctg |
384 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
18655135 |
tttttcgaaaaattgcataaatgctctactttttcagaagtctctg |
18655180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 325 - 372
Target Start/End: Original strand, 46484321 - 46484368
Alignment:
| Q |
325 |
caaaaatacctcactttttcgaaaaattgcataaatgctctacttttt |
372 |
Q |
| |
|
||||||||||||| |||| | ||||||||||||||||| ||||||||| |
|
|
| T |
46484321 |
caaaaatacctcatttttgcaaaaaattgcataaatgccctacttttt |
46484368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 339 - 375
Target Start/End: Original strand, 46419362 - 46419398
Alignment:
| Q |
339 |
tttttcgaaaaattgcataaatgctctactttttcag |
375 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
46419362 |
tttttcaaaaaattgcataaatgccctactttttcag |
46419398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0586 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: scaffold0586
Description:
Target: scaffold0586; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 326 - 375
Target Start/End: Original strand, 7638 - 7687
Alignment:
| Q |
326 |
aaaaatacctcactttttcgaaaaattgcataaatgctctactttttcag |
375 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7638 |
aaaaatgcttcactttttcgaaaaattgcataaatgccctactttttcag |
7687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0586; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 326 - 375
Target Start/End: Complemental strand, 8733 - 8684
Alignment:
| Q |
326 |
aaaaatacctcactttttcgaaaaattgcataaatgctctactttttcag |
375 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
8733 |
aaaaatgcctcactttttcgaaaaattgcacaaatgccctactttttcag |
8684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1234 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold1234
Description:
Target: scaffold1234; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 325 - 375
Target Start/End: Original strand, 1801 - 1851
Alignment:
| Q |
325 |
caaaaatacctcactttttcgaaaaattgcataaatgctctactttttcag |
375 |
Q |
| |
|
||||||| || |||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
1801 |
caaaaatgccccactttttcgaaaaattgcaaaaatgccctactttttcag |
1851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000006; HSPs: 7)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 325 - 374
Target Start/End: Original strand, 24742776 - 24742825
Alignment:
| Q |
325 |
caaaaatacctcactttttcgaaaaattgcataaatgctctactttttca |
374 |
Q |
| |
|
|||||||||| ||||||||||||||||| || |||||| ||||||||||| |
|
|
| T |
24742776 |
caaaaataccccactttttcgaaaaattacacaaatgccctactttttca |
24742825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 336 - 375
Target Start/End: Original strand, 23211332 - 23211371
Alignment:
| Q |
336 |
cactttttcgaaaaattgcataaatgctctactttttcag |
375 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
23211332 |
cactttttcgaaaaattgcaaaaatgccctactttttcag |
23211371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 325 - 370
Target Start/End: Original strand, 13102402 - 13102447
Alignment:
| Q |
325 |
caaaaatacctcactttttcgaaaaattgcataaatgctctacttt |
370 |
Q |
| |
|
||||||| |||||||||||| |||||||||| |||||| ||||||| |
|
|
| T |
13102402 |
caaaaatgcctcactttttcaaaaaattgcacaaatgccctacttt |
13102447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 339 - 384
Target Start/End: Original strand, 33854406 - 33854451
Alignment:
| Q |
339 |
tttttcgaaaaattgcataaatgctctactttttcaggggtctctg |
384 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||| ||||||| |
|
|
| T |
33854406 |
tttttcgaaaaattgcataaataccctactttttcagaagtctctg |
33854451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 337 - 373
Target Start/End: Original strand, 39195609 - 39195645
Alignment:
| Q |
337 |
actttttcgaaaaattgcataaatgctctactttttc |
373 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||| |
|
|
| T |
39195609 |
actttttcgaaaaattgcataaataccctactttttc |
39195645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 337 - 373
Target Start/End: Complemental strand, 39197866 - 39197830
Alignment:
| Q |
337 |
actttttcgaaaaattgcataaatgctctactttttc |
373 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||| |
|
|
| T |
39197866 |
actttttcgaaaaattgcataaataccctactttttc |
39197830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 337 - 373
Target Start/End: Complemental strand, 51970093 - 51970057
Alignment:
| Q |
337 |
actttttcgaaaaattgcataaatgctctactttttc |
373 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||| |
|
|
| T |
51970093 |
actttttcgaaaaattgcataaataccctactttttc |
51970057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0012 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0012
Description:
Target: scaffold0012; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 337 - 373
Target Start/End: Original strand, 191199 - 191235
Alignment:
| Q |
337 |
actttttcgaaaaattgcataaatgctctactttttc |
373 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
191199 |
acttttttgaaaaattgcataaatgccctactttttc |
191235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University