View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12858_low_4 (Length: 327)
Name: NF12858_low_4
Description: NF12858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12858_low_4 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 20 - 327
Target Start/End: Original strand, 22270457 - 22270760
Alignment:
| Q |
20 |
tttttatatatcggcttttctcgagagatatgtcactgtgcttgtcgcgacattaacgtgtaggaggaaatttt-tatgcctctcgcaaaaaggaccatg |
118 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||| ||||||||||||||| | ||| || ||||||||||||| |||||||||||| |||||||| ||| |
|
|
| T |
22270457 |
tttttatatatcggtttttctcgggagatatgtcattgtgcttgtcgcgacttcaacatgcaggaggaaattttctatgcctctcgcgaaaaggactatg |
22270556 |
T |
|
| Q |
119 |
actacttcctcctccgtatgagtctagtcttgtggaggagattctccacgatgagcaggagaaagatatttgtggtatggattctgatttccgatttctc |
218 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||| |||| ||| |||||||||||||||||||||||| |
|
|
| T |
22270557 |
actacttcctcctccgtct-----aagtcttgtggaggagattctccacgatgagaaggagaaagacatttctggcatggattctgatttccgatttctc |
22270651 |
T |
|
| Q |
219 |
ggaggcagcatccgctgccacatttatttaagtagcggtttgttgattttggtgagcgacctcgatttgagtcgggattgtagtaggaattttatcttga |
318 |
Q |
| |
|
|||| |||||||||||| |||||||||| |||||||||||||||||||||| ||||||||||||||||||| || ||||| ||||||||||| |||||| |
|
|
| T |
22270652 |
agaggtagcatccgctgctacatttatttgagtagcggtttgttgattttggcgagcgacctcgatttgagttggtattgtggtaggaattttttcttga |
22270751 |
T |
|
| Q |
319 |
ttttcttct |
327 |
Q |
| |
|
||||||||| |
|
|
| T |
22270752 |
ttttcttct |
22270760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University