View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12859_high_2 (Length: 669)
Name: NF12859_high_2
Description: NF12859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12859_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 3e-62; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 3e-62
Query Start/End: Original strand, 57 - 194
Target Start/End: Original strand, 26834777 - 26834914
Alignment:
| Q |
57 |
gtctcaagtggcattgcaaggagagaaggaacaatggtgtgttcatgaaagaatttaggttacctgagaatgcaaaagttgatgatgtcaaggcttcaat |
156 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26834777 |
gtctcaagtggcattgcaaggagagaaagaacaatggtgtgttcatgaaggaatttaggttaccggagaatgcaaaagttgatgatgtcaaggcttcaat |
26834876 |
T |
|
| Q |
157 |
gcatgatggagtgttgagtataaaattggttaaggatg |
194 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26834877 |
gcatgatggagtgttgactataaaattggttaaggatg |
26834914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 254 - 331
Target Start/End: Original strand, 26834983 - 26835060
Alignment:
| Q |
254 |
gatggtgaaggggtttctcacaaaggaattggacgttttgtttgttgcaaagcttagaacttttcatccaaatgtgtt |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26834983 |
gatggtgaaggggtttctcacaaaggaattggacgttttgtttgttgcaaagcttagaacttttcatccaaatgtgtt |
26835060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University