View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12859_high_21 (Length: 405)
Name: NF12859_high_21
Description: NF12859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12859_high_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 40 - 400
Target Start/End: Complemental strand, 35210674 - 35210310
Alignment:
| Q |
40 |
caacaattctaatatcgggtcatacatatgattatgtaacctgaacgaaatagaaattgaatttgtgaagcaccttcatagccatttggatagcaattat |
139 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
35210674 |
caacaattctaatatcgggtcataaatatgattatgtaacctgaacgaaatagaaattgaatttgtgaagcaccttcatagccatttggatagcaatgat |
35210575 |
T |
|
| Q |
140 |
acattga---aaaactgaaaaattcttactccaagacatccttcttcttttgaaagatgcatcatgtctcaactgaac-tagttgatctttctatgcacc |
235 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35210574 |
acattgatcaaaaactgaaaaattcttactccaagacatccttcttcttttgaaagatgcatcatgtctcaactgaacctagttgatctttctatgcacc |
35210475 |
T |
|
| Q |
236 |
agaccaccttaacaaataaaccttctatgaatttaacaaaattcatttatcaacccttcatagcctcttgccaaccataaatcactagttggacttttgt |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35210474 |
agaccaccttaacaaataaaccttctatgaatttaacaaaattcatttatcaccccttcatagcctcttgccaaccataaatcactagttggacttttgt |
35210375 |
T |
|
| Q |
336 |
taacgatgactatcatggacgttcgagagaaaatacatatacacatccccttcattcatctctct |
400 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35210374 |
taacaatgactatcatggacgttcgagagaaaatacatatacacatccccttcattcatttctct |
35210310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University