View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12859_high_50 (Length: 227)
Name: NF12859_high_50
Description: NF12859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12859_high_50 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 17 - 215
Target Start/End: Complemental strand, 20387881 - 20387683
Alignment:
| Q |
17 |
aatatggacaagaacattcatcatgcaaaatagattataaattgttgttttattctgtgactaattattgctttgctgtgtacgaaccatatgcaaacta |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
20387881 |
aatatggacaagaacattgatcatgcaaaatagtttataaattgttgttttattctgtgactaattattgctttgctgtgtacgatccatatgcaaacta |
20387782 |
T |
|
| Q |
117 |
ttgctatatgacttaaatagtttataaatgcttatggtatatatcaaaaggcaataatgcacatgtaaagtcaacgggtataatcaaaaagcctatgct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20387781 |
ttgctatatgacttaaatagtttataaatgcttatggtatatatcaaaaggcaataatacacatgtaaagtcaacgggtataatcaaaaagcctatgct |
20387683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University