View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12859_low_15 (Length: 451)
Name: NF12859_low_15
Description: NF12859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12859_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 273; Significance: 1e-152; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 167 - 443
Target Start/End: Complemental strand, 47287005 - 47286729
Alignment:
| Q |
167 |
ccctctagcaatcaaggagaatgggaactaatacaaccaaccattggcatttcagctatgcacatgcaactttcacacaacaataaaatcataattttcg |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47287005 |
ccctctagcaatcaaggagaatgggaactaatacaaccaaccattggcatttcagctatgcacatgcaactttcacacaacaataaaatcataattttcg |
47286906 |
T |
 |
| Q |
267 |
atcgaaccgattttggcccttcaaatctccctctttcaaatggccggtgtcgtatggatccattcgacactgcccttaaaattgattgcactgctcactc |
366 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47286905 |
atcgaaccgattttggcccttcaaatctccctctttcaaatggccggtgtcgtatggatccattcgacactgcccttaaaattgattgcactgctcactc |
47286806 |
T |
 |
| Q |
367 |
tgttctatacgacattgccacaaatacattccgatccttaactgtacaaacagacacttggtgttccacaggttctg |
443 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
47286805 |
tgttctatacgacattgccacaaatacattccgatccttaactgtacaaacagacacttggtgttcctcaggttctg |
47286729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 17 - 82
Target Start/End: Complemental strand, 47287158 - 47287093
Alignment:
| Q |
17 |
cttttctcttctaacccacccaaaatgagctctatcacattaatcttaattttcttcatactatct |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47287158 |
cttttctcttctaacccacccaaaatgagctctatcacattaatcctaattttcttcatactatct |
47287093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University