View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12859_low_38 (Length: 285)
Name: NF12859_low_38
Description: NF12859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12859_low_38 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 263
Target Start/End: Original strand, 32955823 - 32956088
Alignment:
| Q |
1 |
tgagtctccaagaaaggaaattaggaatgccattttctgattctgcatctgaatcatccatgaaacgtagctcattgccatacatttgactctgtggttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32955823 |
tgagtctccaagaaaggaaattaggaatgccattttctgattctgcatctgaatcatccatgaaacgtagctcattgccatacatttgactctgtggttg |
32955922 |
T |
|
| Q |
101 |
tgagtaccatgaattgt---tgttgttgttactgtagaagtttcctgactccattatgccgccgttagtcgcggctgtcgtggcaaccgcggcgtttgct |
197 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| ||| |
|
|
| T |
32955923 |
tgagtaccatgaattgttgttgttgttgttactgtagaagtttcctgactccattatgccaccgttagtcgcagctgtcgtggcaaccgcggcgttcgct |
32956022 |
T |
|
| Q |
198 |
cttctctcttccttcttgtatctaatcccacaagcattgcatagtgactgcaatttcaattcaacc |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32956023 |
cttctctcttccttcttgtatctaatcccacaagcattgcatagtgactgcaatttcaattcaacc |
32956088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 193 - 252
Target Start/End: Complemental strand, 7723739 - 7723680
Alignment:
| Q |
193 |
ttgctcttctctcttccttcttgtatctaatcccacaagcattgcatagtgactgcaatt |
252 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||| |||||||||| |||||| |||| |
|
|
| T |
7723739 |
ttgctcttctctcttccttcttgaatctgatcccacatgcattgcataatgactgtaatt |
7723680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University