View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12859_low_42 (Length: 257)
Name: NF12859_low_42
Description: NF12859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12859_low_42 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 6e-86; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 18 - 252
Target Start/End: Complemental strand, 43257368 - 43257125
Alignment:
| Q |
18 |
ctagaaaaggatcctttgttgtcaaggcagctgctcctgtcaaggtttatctctcactcaaatttttcttaat--tatgtttgctttttattaataatag |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43257368 |
ctagaaaaggatcctttgttgtcaaggcagctgctcctgtcaaggtttatctctcactcaaatttttcttaattatatgtttgctttttattaataatag |
43257269 |
T |
 |
| Q |
116 |
tgtctcagatgaccatattacaaccgattcgtttaattttatgtctcttgaggttacaaagtcaactctaaccactgaactaacgcc------------a |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
43257268 |
tgtctcagatgaccatattacaaccgattc-----tttctatgtctcttgaggttacaaagtcaactctaaccactgaactaacgcctctttgacaagta |
43257174 |
T |
 |
| Q |
204 |
tgcatgtgctttgaactatgtttatactaaaaataactttcttctctct |
252 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43257173 |
tgcatgtgctctgaactatgtttatactaaaaataactttcttttctct |
43257125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 18 - 139
Target Start/End: Complemental strand, 43260964 - 43260834
Alignment:
| Q |
18 |
ctagaaaaggatcctttgttgtcaaggcagctgct------cctgtcaaggtttatctctcactcaaatttttcttaattat--gtttgcttttt-atta |
108 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| || ||||| ||||| |||||||||||||| |||| ||||| ||| ||||||||||| |||| |
|
|
| T |
43260964 |
ctagaaaaggttcctttgttgtcaaggcagcttcttctcctcctgttaaggtctatctctcactcaatttttccttaaatatatgtttgctttttcatta |
43260865 |
T |
 |
| Q |
109 |
ataatagtgtctcagatgaccatattacaac |
139 |
Q |
| |
|
||||||||||||| ||||| ||||||||||| |
|
|
| T |
43260864 |
ataatagtgtctctgatgatcatattacaac |
43260834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 157 - 196
Target Start/End: Complemental strand, 43260831 - 43260792
Alignment:
| Q |
157 |
tgtctcttgaggttacaaagtcaactctaaccactgaact |
196 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43260831 |
tgtctcttgaagttacaaagtcaactctaaccactgaact |
43260792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University